skb-f (human skeletal myoblasts) (ZenBio)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ZenBio skb-f (human skeletal myoblasts)
Skb F (Human Skeletal Myoblasts), supplied by ZenBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/skb-f+(human+skeletal+myoblasts)/skb+f++human+skeletal+myoblasts+/10__3390_slash_ijms252312674-478-0-4
Average 90 stars, based on 1 article reviews

skb-f (human skeletal myoblasts) - by Bioz Stars, 2026-09

90/100 stars

Images

Sequencing:

Article Title: Exon skipping oligomer conjugates for muscular dystrophy
Article Snippet: .. Targeting Sequence TS SEQ Name (TS) ID NO. 5′ 3′ PMO#1 CTGTTCCAAATCC 1 EG3 H TGCATTGTTGCC PPMO#1 CTGTTCCAAATCC 1 EG3 -G-R6 TGCATTGTTGCC Specifically, healthy human myoblasts (passage 5-6, SKB-F-SL purchased from Zen-Bio, Inc.) were plated at ̃40% confluency when treated with PMO #1 or PPMO #1 at various concentrations (i.e., 40 μm, 20 μm, 10 μm, 5 μm, 2.5 μm, and 1.25 μm) in SKM-M media (Zen-Bio, Inc.). .. After ninety-six hours of incubation, myoblasts were washed with PBS and lysed by RA1 lysis buffer in the Illustra GE RNAspin 96 kit (Cat #25-055-75, GE Healthcare Bio-Sciences).

Article Title: Exon skipping oligomer conjugates for muscular dystrophy
Article Snippet: .. Targeting Name Compound Sequence sequence ID NO. 5′ 3′ PMO#1 GTT GCC TCC GGT TCT GAA H53(+36+60) EG3 H GGT GTT C PPMO#1 GTT GCC TCC GGT TCT GAA H53(+36+60 R6G) EG3 GR6Ac GGT GTT C Specifically, healthy human myoblasts (passage 5-6, SKB-F-SL purchased from Zen-Bio, Inc.) were cultured to reach 80-90% confluency in SKM-M media prior to initiation of differentiation by incubating in low serum media (SKM-D, Zen-Bio, Inc.) Five-days after differentiation, mature myotubes were incubated with the above compounds at various concentrations (i.e., 40 μm, 20 μm, 10 μm, 5 μm, 2.5 μm, and 1.25 μm). .. After ninety-six hours of incubation, myotubes were washed with PBS and lysed by RLT lysis buffer from the RNeasy Micro kit (Cat #74004, Qiagen).

Article Title: Exon skipping oligomer conjugates for muscular dystrophy
Article Snippet: .. Targeting TS SEQ Name Sequence (TS) ID NO. 5′ 3′ PMO#1 GTTGCCTCCGGTTCTGAAG 1 EG3 H GTGTTC PPM#1 GTTGCCTCCGGTTCTGAAG 1 EG3 -G-R6 GTGTTC Specifically, healthy human myoblasts (passage 5-6, SKB-F-SL purchased from Zen-Bio, Inc.) were plated at ̃40% confluency when treated with PMO #1 or PPMO #1 at various concentrations (i.e., 40 μm, 20 μm, 10 μm, 5 μm, 2.5 μm, and 1.25 μm) in SKM-M media (Zen-Bio, Inc.). .. After ninety-six hours of incubation, myoblasts were washed with PBS and lysed by RA1 lysis buffer in the Illustra GE RNAspin 96 kit (Cat #25-055-75, GE Healthcare Bio-Sciences).

Article Title: Exon skipping oligomer conjugates for muscular dystrophy
Article Snippet: .. TS SEQ Name Targeting Sequence (TS) ID NO. 5′ 3′ PMO#1 CAATGCCATCCTGGAGTTCCTG 1 EG3 H PPMO#1 CAATGCCATCCTGGAGTTCCTG 1 EG3 -G-R6 Specifically, healthy human myoblasts (passage 5-6, SKB-F-SL purchased from Zen-Bio, Inc.) were plated at ̃40% confluency when treated with PMO #1 or PPMO #1 at various concentrations (i.e., 40 μm, 20 μm, 10 μm, 5 μm, 2.5 μm, and 1.25 μm) in SKM-M media (Zen-Bio, Inc.). .. After ninety-six hours of incubation, myoblasts were washed with PBS and lysed by RA1 lysis buffer in the Illustra GE RNAspin 96 kit (Cat #25-055-75, GE Healthcare Bio-Sciences).

Article Title: Exon skipping oligomer conjugates for muscular dystrophy
Article Snippet: .. TS SEQ Name Targeting Sequence (TS) ID NO. 5′ 3′ PMO#1 CTCCAACATCAAGGAAGATGGCA 1 EG3 H TTTCTAG PPMO#1 CTCCAACATCAAGGAAGATGGCA 1 EG3 -G-R6 TTTCTAG Specifically, healthy human myoblasts (passage 5-6, SKB-F-SL purchased from Zen-Bio, Inc.) were plated at ̃40% confluency when treated with PMO #1 or PPMO #1 at various concentrations (i.e., 40 μm, 20 μm, 10 μm, 5 μm, 2.5 μm, and 1.25 μm) in SKM-M media (Zen-Bio, Inc.). .. After ninety-six hours of incubation, myoblasts were washed with PBS and lysed by RA1 lysis buffer in the Illustra GE RNAspin 96 kit (Cat #25-055-75, GE Healthcare Bio-Sciences).

other:

Article Title: gnas Knockdown Induces Obesity and AHO Features in Early Zebrafish Larvae
Article Snippet: SKB-F (human skeletal myoblasts, Zen-Bio, Durham, NC, USA) and A5 4 9 cell lysates were used as positive controls.

Cell Culture:

Incubation:

Cell Differentiation:

Article Title: Precision targeting of autoantigen-specific B cells in muscle-specific tyrosine kinase myasthenia gravis with chimeric autoantibody receptor T cells.
Article Snippet: .. Primary human skeletal muscle cells (ZenBio, SKB-F) were differentiated for 6–7 days using skeletal muscle cell differentiation medium (ZenBio, SKM-D). .. Next, 5 nM of neural agrin (R&D Systems, catalog no. 550-AG/ CF) was added into differentiated primary human skeletal muscle cells for 16 h. MuSK phosphorylation was detected by ELISA (RayBiotech, catalog no. PEL-MUSK-Y-1) according to the manufacturer’s protocol.

Review